Product Information
This product is a PDI sh-RNA expression plasmid constructed using the pLVX-sh-zsGreen-Puro vector plasmid. It has been verified by protein expression levels, and it is confirmed to be an effective PDI sh-RNA expression plasmid.
Plasmid message
Carrier vector | pLVX-sh-zsGreen-Puro |
Plasmid type | Lentiviral expression vector; shRNA expression vector |
Clone Method | Multiple clone site, restriction enzyme |
Promoter | U6; PGK; CMV |
5' Sequencing primers and sequences | U6: GACTATCATATGCTTACCGT |
Resistance | Ampicillin |
Filter labels | Puromycin、zsGreen |
Clone Strain | E.coli cells (RecA-) |
Host cell | Mammalian cell |
Remarks | pLVX-sh-zsGreen-Purolentiviral expression vector is a lentiviral vector derived from HIV, which can be used for shRNA expression and cloning, efficient cell transfection to establish stable cell lines. The U6 promoter drives high-level expression of shRNA, while the PGK and CMV promoters drive moderate-level expression of the reporter gene. |
Stability | Stable expression |
Formative/Inductive | Formative |
Viral and non-viral | Lentivirus |
Storage
Stored at -20℃ for 12 months.
Usage
Package the lentivirus
1. Prepare 293T cells the day before transfection. Ensure the cell density reaches 70%-90% during transfection.
2. Transfection: Lentivirus packaging needs three plasmids: sh-RNA vector, PSPAX2 and PMD2.G.
① Dilute sh-RNA vector and PSPAX2,PMD2.G (3:2:1) in 100 uL Opti-MEM Medium.
② Dilute transfection reagent 10 uL in 100 uL Opti-MEM Medium.
③ Incubate for 5 minutes at room temperature.
④ Add diluted DNA to diluted transfection reagent (1:1 ratio).
⑤ Incubate complexes at room temperature for 20 min, and then slowly transfer the solution to the 6-well plate.
⑥ Incubate the cells in a 37°C incubator with a humidified atmosphere of 5% CO2.
⑦ Replacement antibiotic free medium with 2 mL complete medium after 4 hours.
Infect cells with lentivirus
After transfected 48 hours, the virus has been formation, it contains in the DMEM.
The target cells need to be pavemented.
The cell density up to about 50%-60%. The referred steps as follows:
① Add polybrene to the target cell medium, be sure the final concentration of polybrene is 8 ug/mL. The polybrene is a reagent to help the virus infect the cell.
② Collect lentivirus in 293T medium into a tube and centrifuge at 4000 rpm for 1 min.
③ Add 1 mL virus into the target cell.
④ When all the components be added into six well plates, centrifuge 2500 rpm for 30 min.
⑤ After infected 18 hours, change the solution with the fresh medium.
After infection for 48 hours, select cells by puromycin restriction.
Notes
1. When handling lentiviruses, it is recommended to use a Biosafety Cabinet (BL-2 level).
2. When handling lentiviruses, wear lab coats, masks, and gloves, and avoid exposing bare hands or arms.
3. Exercise extreme caution during handling to prevent aerosolization or splashing. If the laminar flow hood becomes contaminated, immediately clean it with a 10% sodium hypochlorite solution (or a mixture of 70% ethanol and 1% SDS). All virus-contaminated items-including pipette tips, centrifuge tubes, culture plates, and culture media must be soaked in 10% sodium hypochlorite solution for at least 1 hour before disposal.
4. For centrifugation, use a properly sealed centrifuge tube.
5. After lentivirus manipulation, remove gloves and wash hands with soap and water.
Cited in Article as
hsh2806b, PDI sh-RNA vector, Proteintech, IL, USA
Documentation
| Datasheet |
|---|
| PDI sh-RNA vector Datasheet |